Sitio destinado al encuentro y unión, para obtener un ámbito de comunicación, difusión, debate y fomento para el desarrollo de la apicultura. Apicultura Uruguay.

Suscribete a Apicultura Uruguay y recibe las noticias en tu correo

Búsqueda de artículos:

ASAMBLEA NACIONAL DE APICULTORES URUGAUY 19 DE NOVIEMBRE 2016

jueves, 19 de enero de 2012

La Multinacional BASF no venderá mas transgénicos en Europea.

En Europa la sociedad y los consumidores si tienen poder y son escuchados.

BASF no venderá mas transgénicos en Europa, la salud del resto del mundo no importa, será salud de tercer mundo…

 

Amigos de la Tierra celebra la renuncia de Basf a vender transgénicos

 

MADRID, 17 Ene. (EUROPA PRESS) -

   La organización Amigos de la Tierra ha celebrado el anuncio que la multinacional Basf realizó este martes en el que renuncia a vender productos transgénicos en Europa y anima al resto de la industria de organismos genéticamente modificados a seguir su ejemplo.

Foto: EUROPA PRESS

 

   La multinacional química alemana anunció este lunes su decisión de abandonar el mercado europeo de semillas transgénicas al reconocer la "falta de aceptación en muchos lugares de Europa por parte de la mayoría de consumidores, agricultores y políticos". Con ello, se retira la patata transgénica Amflora cuyo cultivo fue aprobado hace dos años y de la que se han cultivado unas decenas de hectáreas y que, ha supuesto, según Amigos de la Tierra, "otro gran fracaso para la industria de los transgénicos, tras múltiples escándalos de contaminación".

   A este respecto, el responsable de agricultura y alimentación de Amigos de la Tierra, David Sánchez, considera que la decisión de BASF es "un aviso" para otras empresas como Monsanto, Syngenta o Bayer que "siguen presionando para introducir cultivos transgénicos en Europa".

   A su juicio, el ejemplo de BASF demuestra que forzar la voluntad de los consumidores y de la gran mayoría de agricultores, "ni siquiera es rentable económicamente".

   "Animamos al resto de la industria de los transgénicos a seguir el ejemplo de BASF y reconocer que el futuro de la agricultura y alimentación en Europa y en el resto del mundo, pasa por un modelo social y sostenible, en el que cada vez está más claro que las semillas modificadas genéticamente no jugarán ningún papel", ha apostillado.

Fuente: http://www.europapress.es

 

 

 

 

Ricardo Carrera

Blog: http://apiculturauruguay.blogspot.com/

 

martes, 10 de enero de 2012

"al comer transgénicos estamos comiendo veneno".Christian Vélot, profesor de genética molecular en la Universidad de París.

Científicos confirman en Madrid los graves impactos de los transgénicos.

 

Conclusiones de las Jornadas Científicas Internacionales sobre Transgénicos organizadas por diversas organizaciones agrarias, ecologistas y de consumidores

 

Durante los días 10 y 11 de noviembre de 2011 Madrid ha acogido la celebración de las Jornadas Científicas Internacionales sobre Transgénicos, un evento organizado por Plataforma Rural, COAG, Ecologistas en Acción, Amigos de la Tierra, Greenpeace y CECU. Expertos españoles y europeos exponen en Madrid los impactos ambientales, sociales, económicos y riesgos para la salud de los OGM

 

Fuente: http://www.boletinagrario.com

11-11-2011   Varias Organizaciones

Una importante representación de científicos europeos y españoles ha expuesto este jueves y viernes, en Madrid, sus principales hallazgos sobre los riesgos e impactos de los cultivos y alimentos transgénicos, en el transcurso de las Jornadas Científicas Internacionales sobre Transgénicos ""Los transgénicos en el ámbito científico, agrícola, medioambiental y de la salud"". Durante estos dos días se han puesto sobre la mesa suficientes evidencias científicas sobre sus impactos ambientales, sociales y económicos y sobre sus riesgos para la salud como para rechazar su introducción en la agricultura y la alimentación.

Las jornadas, que han tenido lugar en la Escuela de Organización Industrial (EOI), y han sido organizadas por Amigos de la Tierra, CECU, COAG, Ecologistas en Acción, Greenpeace y Plataforma Rural, han reunido, entre otros, a científicos como: Giles Eric Serallini, Angelika Hilbeck, Christian Vélot, Mª del Carmen Jaizme-Vega, Julien Milanesi, Rosa Binimelis, Ana Carretero, Antonio Gómez Sal, Jorge Riechmann, Michael Antoniou o Julio César Tello Marquina.

Una de las conclusiones principales a las que han llegado de forma unánime los ponentes es que el cultivo de los transgénicos al aire libre supone un grave peligro para la salud y el medio ambiente, y no tiene nada que ver con el empleo de esta tecnología en laboratorio, en ambientes confinados, como su uso con fines médicos.

Michael Antoniou, experto en genética molecular y médica del King’s College, ha destacado durante su intervención que la tecnología de los transgénicos se basa en conceptos genéticos ya superados por la ciencia, que no están abalados por los últimos hallazgos de la genética. A su vez el catedrático de biología molecular de la Universidad de Caen, Gilles Seralini, ha señalado que los mecanismos de evaluación de riesgo previos a la liberación de un transgénico no están diseñados para proteger ni la salud, ni el medio ambiente.

Por su lado, la doctora en ciencias biológicas, Mª del Carmen Jaizme, ha asegurado que los microorganismos del suelo también son víctimas de los cultivos transgénicos, y por lo tanto la fertilidad de nuestros suelos y nuestra alimentación están en juego.

En otra de las ponencias, Christian Vélot, profesor de genética molecular en la Universidad de París, ha apuntado que casi la totalidad de las plantas transgénicas producen pesticidas en sus células o son cultivadas con enormes dosis de pesticidas. Con la conclusión de que "al comer transgénicos estamos comiendo veneno".

También se ha recogido la experiencia de agricultores españoles como Jeromo Aguado, Presidente de la Plataforma Rural y Antonio Ruíz, ex-Presidente del Comité Aragonés de Agricultura Ecológica. Además de un interesante debate entre  miembros del Parlamento Europeo sobre la Evaluación de riesgos en materia de OMG, así como la propuesta de cambio legislativo de la Comisión Europea.

España es el único país de la UE que cultiva transgénicos a gran escala. Durante las últimas legislaturas, el Gobierno ha ignorado sistemáticamente los argumentos ambientales, sanitarios, económicos y sociales que han llevado a otros países europeos como Francia, Alemania, Suiza o Hungría a prohibir el cultivo del maíz transgénico que se cultiva en España. Los organizadores de esta jornada exigen al próximo gobierno que considere la desastrosa experiencia del cultivo de transgénicos en nuestro país y las evidencias científicas de sus impactos, prohibiendo el cultivo de transgénicos como una de sus primeras medidas. En plena campaña electoral, existen motivos más que suficientes para que los partidos se posicionen en un tema clave para el futuro de nuestra agricultura y alimentación.

 

Para ver el video de ¿Qué son los OMG? Consecuencias sanitarias y ambientales de los OMG agrícolas siga el siguiente links: http://www.eoi.es/mediateca/video/1238

 

 

 

Ricardo Carrera

Blog: http://apiculturauruguay.blogspot.com/

 

lunes, 9 de enero de 2012

Un estudio de Melacrom, clave para un fallo judicial europeo para dejar sin efecto una sentencia que pone en riesgo las exportaciones

La ingeniera Paula Lanzelotti presentó un novedoso trabajo sobre implicancias de la presencia de polen proveniente de plantas transgénicas en miel • Esperan que sea tenido en cuenta para dejar sin efecto una sentencia que pone en riesgo las exportaciones.

La Directora Técnica del Laboratorio Melacrom, Paula Lanzelotti, fue invitada a Alemania para cerrar las conferencias plenarias de un taller de trabajo sobre las implicancias técnicas y legales de la presencia de polen proveniente de plantas transgénicas en miel.

 

Fuente: http://elnuevocronista.com.ar

 

PAULA LANCELOTTI, EXPONIENDO LOS RESULTADOS DE SU TRABAJO.

 

 

La ingeniera en alimentos Lanzelotti, que dirige el laboratorio mercedino junto al ingeniero industrial Mauricio Maldonado, habló sobre cómo surgió la posibilidad de realizar esta importante disertación en Berlín en diciembre pasado. “La apicultura está pasando un momento difícil porque hay una sentencia de la Corte Suprema europea que discrimina las mieles que tienen polen de plantas transgénicas, y como en Argentina hay bastante soja transgénica surge un problema para exportarla. Como todavía no está reglamentada la sentencia en Europa y se está a tiempo de presentar posiciones para que la Comisión Europea tome en cuenta, nosotros preparamos un estudio técnico con salidas novedosas para Europa y que resultaron interesantes para el Ministerio de Cultura en Alemania”, dijo.

A raíz de este estudio técnico, Lanzelotti fue invitada para hacer el cierre de un taller donde se iba a debatir sobre las implicancias del fallo de la Corte. El contacto del laboratorio mercedino con Alemania fue por Internet y el viaje se organizó en menos de 24 horas. “El trabajo era muy novedoso y ellos estaban muy necesitados de encontrarle una vuelta técnica al asunto”, contó y agregó que como el tema de transgénicos en Alemania es muy delicado, antes de viajar se reunieron con el Ministerio de Agricultura de la Nación para presentar la posición argentina ante la Unión Europea frente a este problema.

Según comentó la ingeniera, el trabajo del laboratorio fue tomado por el Ministerio de Agricultura de Alemania, las cámaras importadoras de miel de Europa, el Agregado Agrícola Argentino, y algunas embajadas como la de Estados Unidos y la de México.

 

Otro viaje

 

Actualmente Lanzelotti está planeando un viaje a Bruselas que es donde está asentada la Comisión Europea, para presentar el trabajo directamente en ese lugar. “Ahora el trabajo lo tienen en manos el agregado agrícola Argentino y el Ministerio de Agricultura de Alemania. En función de lo que surja en enero y febrero eventualmente podría viajar otra vez para presentar la exposición ante la Comisión que tiene que decidir cómo implementar este fallo de la justicia europea”, indicó.

 

El estudio

 

El trabajo presentado por Lanzelotti en España es un intento de conciliar el espíritu de preservación del medio ambiente y de la salud del consumidor imperante la comunidad europea, con la sustentabilidad de las apiculturas regionales. Se demuestra que legalmente no resulta necesaria la rotulación de la miel en el caso que contenga polen con material genético modificado, cuando se encuentra aprobado en la Unión Europea, como es el caso de la amplia mayoría de los eventos transgénicos presentes en Argentina. Se espera que la Comisión Europea, que es quien debe decidir cómo se hará la implementación de este fallo judicial de la Corte Suprema de Justicia europea, tome en cuenta lo que se plantea en el mismo.

Mediante esta propuesta técnica, también sería posible evitar la mayor parte de los análisis de material genético de los embarques destinados a la UE. A pesar de que el Laboratorio Melacrom se sostiene económicamente con la realización de controles de calidad en miel, y que esto puede parecer una contradicción frente a los intereses inmediatos del Laboratorio, la política de esta empresa es hacer un uso ético y responsable de la posición que ocupa dentro de la misma, actuando en vista del bien de todo el sector apícola, cuidando la sustentabilidad del rubro en el largo plazo.

 

La exportación de miel, paralizada 

Actualmente la importación de miel desde Europa está paralizada ya que a partir de la mencionada sentencia, la miel –que tiene polen de plantas genéticamente modificadas- entra dentro de la órbita de un reglamento específico que en Europa rige para ese tipo de alimentos. “Si se encuentra dentro de un laboratorio que la miel tiene polen de plantas no aprobadas, pasa a ser ilegal. Entonces la decomisan y la incineran. Y eso para el productor, el empacador y el supermercado es una catástrofe económica, entonces directamente no compran”, remarcó Lanzelotti.

 

 

 

 

Ricardo Carrera

Blog: http://apiculturauruguay.blogspot.com/

 

México: 2a Conferencia Mundial en Apicultura Orgánica 2011

Estimados todos,

Con mucho gusto les comunicamos nuevamente que del 19 al 25 de marzo 2012, organizaremos la Segunda Conferencia Mundial en Apicultura Organica, en San Cristóbal de Las Casas, Chiapas, México.

Toda la información relevante se encuentra en http://www.ecosur.mx/abejas

Será un espacio abierto a todos: apicultores, investigadores, organizaciones, comercializadores... para intercambiar experiencias y opiniones, exponer nuevos conocimientos, debatir sobre los valores sociales y ambientales de nuestros trabajos, y sobre temas urgentes como los cultivos transgénicos y cómo afectan la apicultura, presentar fotos, videos y recetas, y muchas actividades más.

Destacamos que entre las formas de particicipar, es posible presentar una cápsula, un video breve que presente la apicultura en su pas, de forma dinámica, original e instructiva. Anímense los aficionados a la imagen, esto le dara mucha vida a nuestro encuentro!

La región de los Altos de Chiapas, en toda su diversidad cultural y su riqueza ecológica, les espera para lo que promete ser un gran encuentro.

Agradeceremos a todos su apoyo para difundir esta circular.

El Comité organizador
abejas@ecosur.mx
http://www.ecosur.mx/abejas

 

Muestro mejor deseo de éxito

fernando

 

==========

Fernando Esteban

Director de "Espacio Apícola"
espacioapicola@gmail.com
Tel: +54 (0) 351 4564337 


viernes, 6 de enero de 2012

España: paralización casi absoluta de la venta de la miel

Muchos sostienen que el tema de transgénicos en la miel es una medida para arancelaria . Parece que este artículo no les da la razón.-

 

Fuente: http://www.coag.org Coordinadora de Organizaciones de Agricultores y Ganaderos de España.

 

28/12/2011- BALANCE AGRARIO 2011

 

Apicultura. Durante 2011 la campaña apícola de miel en España ha sufrido una reducción en torno al 50% respecto a la media de un año normal. En el caso de la producción de polen (seco y fresco), la reducción en Castilla y León, principal región productora, ha alcanzado también un 50% menos respecto a la media de un año normal. Hasta septiembre los precios se han mantenido estables respecto a la campaña anterior de 2010, con una media de 2,55 €/kg. para la miel de mil flores y de 2,90 €/kg. para las mieles oscuras, pero la sentencia del Tribunal Superior de Justicia de la Unión Europea (6 septiembre 2011) sobre el contenido de polen OGM en la miel ha dado un giro radical a esta situación, provocando en nuestro país una paralización casi absoluta de la venta de la miel, con una caída de estos precios en torno al 15%. España es casi el único y principal país de la UE que apuesta por cultivos transgénicos y eso ha provocado rechazo en los operadores comerciales. 

En este momento queda una parte importante de la cosecha de miel y polen en los almacenes de los apicultores de nuestro país. 

 

 

Ricardo Carrera

Blog: http://apiculturauruguay.blogspot.com/

 

Una nueva amenaza para las abejas melíferas, la Mosca Parasitarias boreal decapitadoras Apocephalus

Andrew Núcleo 1 , Charles Runckel 2 , Jonathan Ivers 1 ,Christopher Quock 1 , Travis Siapno 1 , Serafina Denault 1 ,Brian Brown 3 , José DeRisi 2 , Christopher D. Smith 1 , John Hafernik 1 *

1 Departamento de Biología, San Francisco State University, San Francisco, California, Estados Unidos de América, 2 Departamento de Bioquímica y Biofísica de la Universidad de California en San Francisco, San Francisco, California, Estados Unidos de América, 3 Sección de Entomología, Museo de Historia Natural de Los Angeles County, Los Angeles, California, Estados Unidos de América

 

Fuente: http://www.plosone.org

Resumen

 

Colonias de abejas están sujetas a numerosos agentes patógenos y parásitos. La interacción entre múltiples agentes patógenos y los parásitos son la causa propuesta para el Trastorno de Colapso de Colonias (CCD), un síndrome caracterizado por las abejas obreras abandonan sus colmenas. Aquí ofrecemos la primera documentación que el boreal volar decapitadoras Apocephalus, se sabía que parasitan a los abejorros, también infecta y, finalmente, mata a las abejas de miel y pueden representar una amenaza emergente para la apicultura del Norte de América. Las abejas parasitadas miel muestran un comportamiento colmena abandono, dejando a sus colmenas en la noche y la muerte poco después. En promedio, siete días más tarde hasta 13 larvas decapitadoras emergen de cada abeja muerta y se convierten en crisálidas lejos de la abeja. Utilizando los códigos de barras de ADN, que confirmó que phorids que surgió de las abejas y abejorros fueron de la misma especie. Análisis de microarrays de abejas de la miel de las colmenas

infectadas reveló que las abejas suelen ser infectados con el virus de las alas deformadas y Nosema ceranae. Phorids larvas y adultos también dio

 

positivo por estos patógenos, lo que implica la marcha como un vector potencial o reservorio de estos patógenos de las abejas.Decapitadoras

 

parasitismo puede afectar la viabilidad de la colmena ya que el 77% de los sitios muestreados en el área de San Francisco fueron infectadas por la mosca

 

y el análisis de microarrays phorids detectado en colmenas comerciales en Dakota del Sur y el Valle Central de California. Entender los detalles de la

 

infección decapitadoras puede arrojar luz sobre comportamientos similares colmena abandono visto en CCD.

 

Introducción

 

La miel de abeja Apis mellifera ha experimentado los últimos inexplicables muertes masivas en todo el mundo [1] . En los Estados Unidos, Colony Collapse Disorder (CCD), un síndrome caracterizado por la pérdida de colmenas y el comportamiento de abandono de la colmena, pone en peligro las colonias de abejas y ha recibido considerable atención científica y los medios de comunicación. Mientras que Estados Unidos es el único país para el cual CCD sensu stricto se ha documentado, también ha habido un aumento en las pérdidas de colonias sin explicación para algunas regiones de Europa y otras partes del mundo [1] - [4] . Al mismo tiempo, algunas regiones de Europa y Asia han reportado pérdidas de colonias es normal. A pesar de las pérdidas catastróficas de las colonias de abejas se han producido en el pasado, la magnitud y la velocidad de las pérdidas de colmenas recientes parecen sin precedentes [1] . Hasta el momento, los sospechosos causales principales han sido los ácaros parásitos, hongos parásitos, enfermedades virales y las interacciones entre ellos [1] - [5] . Mientras que las infecciones virales y microsporidios se han relacionado con aumento de la mortalidad y deterioro de la salud en colonias de abejas [5] , [6] , los estudios no han abordado directamente los cambios de comportamiento involucrados en el abandono de las colmenas.

Las abejas de miel sufren de numerosos parásitos y agentes patógenos, incluyendo virus, bacterias, hongos parásitos y ácaros ectoparásitos [7] . Infecciones de los agentes dentro de cualquiera de estos grupos de patógenos y parásitos pueden ser fatales para las abejas de miel, pero el ácaro parásito Varroa destructor que parece ser el más dañino para las colonias en general. Varroa destructorse ha generalizado en las colmenas de abejas, que afecta a todas las etapas de la vida de las abejas de larva a adulto [8] . Probablemente debido a esto, los apicultores de los parásitos rango de los Estados Unidos como una amenaza mayor para sus colonias de abejas de CCD [1] . El control de ácaros parásitos es mucho tiempo y dinero con el control de daños estimados en miles de millones de dólares en todo el mundo [9] . Por otra parte, V. destructor ha sido implicado como un vector de muchos agentes patógenos que pueden comprometer la salud de la colonia [10] - [12] . Entender las infecciones parasitarias de las abejas es fundamental para predecir la salud a largo plazo de las colmenas de abejas.

Aquí mostramos que Apocephalus boreal, una mosca decapitadoras nativo de América del Norte, que se sabía que parasitan a los abejorros y las avispas de papel [13] , [14] , también ataca a la abeja de la miel no nativos. El Apocephalus género es más conocido por el "moscas decapitar" que parasitan a una gran variedad de especies de hormigas [15] . boreal Apocephalus pertenece al subgénero Mesophora,que es un grupo que contiene las especies que alberga otro ataque de las hormigas. Aunque los anfitriones de la mayoría de las especies del grupo Mesophora se desconocen, los anfitriones previamente descubiertos incluyen una variedad de artrópodos, incluidas las abejas, avispas, escarabajos y arañas, pero no las abejas de miel [14] .

En este trabajo, nos muestran que A. Borealis tiene un profundo efecto en las abejas parasitadas, lo que lleva a abandonar sus colmenas por la noche. Nosotros usamos un microarray de patógenos de artrópodos (APM) [16] para detectar patógenos que han sido implicados en el CCD que están asociados con las moscas adultas y las larvas y para detectar la presencia de phorids en colmenas comerciales en Dakota del Sur y el Valle Central de California. Comprender las causas del comportamiento de abandono de la colmena que el documento podría explicar los síntomas asociados con CCD. Además, el conocimiento de este parásito podría ayudar a prevenir su propagación en las regiones del mundo donde los anfitriones sin usar puede ser fácilmente susceptibles al ataque.

Resultados

 

Hemos encontrado parasitismo generalizado por A. boreal, entre 7417 y 195 abejas abejorros(Bombus vosnesenskii 177, 18 melanopygus Bombus) en la muestra de San Francisco Bay Area localidades ( Figura 1 y Tabla S1 ). En total, el 77% de los sitios de nuestra muestra (24 de 31) dio las abejas parasitadas por A. boreal. Hemos criado phorids de 26 B. vosnesenskii los trabajadores, una B.vosnesenskii reina y una B. melanopygus trabajador.

Figura 1. Distribución de las abejas infectadas por decapitadoras muestras en este estudio (rojo).

El recuadro muestra la condados de San Francisco Bay Area, donde encontramos decapitadoras parasitadas las abejas de miel. Las rutas de las colmenas comerciales probados están indicados (flechas), donde las líneas de puntos representan los estados de las colmenas cruzaron antes de la prueba de microarrays viral y las líneas continuas representan la ruta de las colmenas durante el período de prueba de microarrays. Sitios en los que A. Boreal se conocía anteriormente [7] se indican con puntos negro.

doi: 10.1371/journal.pone.0029639.g001

Utilizando los códigos de barras de ADN, que confirmó que el phorids que surgió de Apis y Bombus no tenía más de 0,2% (1 pb), la divergencia entre las muestras ( Figuras S1 , S2 ). La ligera variación que encontramos fue uno de los criados phorids de las abejas, no entre las moscas criadas de las abejas de miel y cría de los abejorros. Hemos confirmado la identidad de la phorids utilizando criterios morfológicos y de secuenciación de genes 18S rRNA utilizados en la APM. Además, nuestro laboratorio de las infecciones de las abejas (ver más abajo) que se utiliza phorids que había surgido de dos abejas y abejorros. Las moscas de ambos equipos respondieron de la misma manera a la presencia de los trabajadores de miel de abeja. En conjunto, estos datos confirman que la phorids que atacan a las abejas de miel son las mismas especies que los abejorros atacar.

Forrajeo B. vosnesenskii mostraron una mayor tasa de parasitismo de A. decapitadoras melliferarecolectores ( Tabla S3 ). Aunque nuestro tamaño de las muestras individuales de los abejorros son pequeñas debido a su relativa rareza en el verano de 2010, se observaron tasas de parasitismo de hasta un 80% (8 / 10) en una muestra de los abejorros alimentación a partir de septiembre.

En las infecciones de laboratorio, la mosca hembra ataca las abejas de miel poco después de ser colocado en un escenario con ellos. Mujer vuela a cabo una abeja, aterrizó en el abdomen y se inserta su ovipositores en ella de dos a cuatro segundos ( Figura 2A, 2B ). Se observó el mismo comportamiento hacia las abejas a partir phorids criados de abejorros o abejas. Esta interacción es similar a la de otras especies de hormigas que parasitan phorids [17] y las abejas [18] . Las larvas maduras decapitadoras surgió de la unión entre la cabeza de una abeja y el tórax ( fig. 2C ), en promedio, siete días después de la toma (n = 636, Rango = 1.14, SD = 1,68) ( Figura S3 ) y se alejó de la abeja para pupar. Todas las larvas que surgió de las abejas obreras con éxito empupado en condiciones de laboratorio (ver métodos ). Las tasas de producción de campo recogidos abejas iban de uno a 13 larvas maduras por abeja infectada (n = 961, media = 4.8, SD = 2,4) ( Figura. S3B ), lo que vuela el potencial de multiplicarse rápidamente. En el laboratorio, se observó la producción aún mayor con un máximo de larvas de abeja produce 25 pupas. Las moscas adultas surgió en promedio en 28 días (n = 94, rango = 22-36, SD = 1,9) después de la fase de pupa ( Figura S3C ).

Figura 2. Imágenes de Apocephalus boreal y las abejas.

(A) de las mujeres adultas A. boreal. (B) Femenino A. boreal oviposición en el abdomen de una abeja de la miel de los trabajadores. (C) Dos finales larvas de A. boreal de salir de un trabajador de abeja de la miel en la unión de la cabeza y el tórax (flechas rojas).

doi: 10.1371/journal.pone.0029639.g002

Para investigar el comportamiento de la colmena internos y posibles infecciones dentro de una colmena, que mantuvo una colmena de observación en un laboratorio cerca de nuestra colmena principal del estudio. Las muestras tomadas de la colmena de observación en junio de 2010 confirmaron la infección por A. boreal. Las tasas de infección varían entre junio de 2010 y diciembre de 2010 (media = 25% Rango = 12% -38%) alcanzando un máximo durante el período de la muestra en noviembre un 38%. En septiembre, el número de abejas en la colmena se negó y se observó decapitadoras cubiertas pupa pupa y vacíos entre las abejas muertas en la parte inferior de la colmena, lo que indica la emergencia de adultos phorids dentro de la colmena y el potencial de A.boreal a multiplicarse dentro de una colmena e infectar a una reina.

El uso de un microarray de patógenos de artrópodos (APM) [16] , se han detectado cuatro decapitadoras muestras positivas a la que también compartió el 99,8% de identidad en un fragmento de 432 nt del gen 18S rRNA ( Figura S2 ) de las abejas en colmenas comerciales de viaje: dos de Dakota del Sur durante septiembre y octubre de 2009 y dos cerca de Bakersfield, California en enero y febrero de 2010 ( Figura 1 ) [16] . En particular, la APM también se detectó una mayor tasa de infección decapitadoras evidente en las muestras de San Francisco State University en fechas en que los ensayos de emergencia de larvas miden los niveles más bajos de parasitismo. En este sentido, las muestras recogidas entre serie 23 de abril y 18 de junio de 2010 de varios lugares en el campus (Tabla S2 ) phorids detectado en 10 de 31 de las abejas (32%) en comparación con sólo 17 de 244 (7%) detectados por nuestros ensayos de emergencia ( pescadores Test exacto de p <0,0002). Esta diferencia sugiere que la APM es la herramienta más sensible para medir las tasas de infección y que los datos del ensayo aparición proporcionar una estimación conservadora de la abundancia de phorids.

Se seleccionaron los adultos decapitadoras, larvas y abejas parasitadas por patógenos abeja de la miel con la APM [16] , [19] . Decapitadoras adultos y larvas decapitadoras dio positivo para la infección por Nosema ceranae (4 / 8 adultos y 7 / 8 larvas) y virus de las alas deformadas (DWV) (2 / 8 adultos y 6 / 8 larvas) ( Tabla S2 ). Las abejas de las colmenas y las abejas control varados en la muestra de una variedad de lugares infectados comúnmente con N. ceranae (26/36 abejas), y DWV (16/36 abejas). Presencia de ácido nucleico de estos agentes patógenos indica que las partículas están presentes, no es que se replican o están en una forma infecciosa.

Si bien hay informes anteriores de la actividad nocturna de las abejas [20] , somos los primeros en relacionar la actividad de la noche para abandonar la colmena. En primer lugar, encontraron varados abejas de la miel de los trabajadores por debajo de las luces y los artefactos de iluminación dentro del campus de San Francisco State University (37 ° 43'24 .9 "N 122 ° 28'31 x .93" W) ( Figura S4A -C) bajo una variedad de condiciones climáticas incluyendo las frías noches de lluvias, cuando prácticamente no otros insectos fueron vistos alrededor de las luces. Abejas varados mostraron síntomas tales como desorientación (caminar en círculos) y pérdida de equilibrio (no puede pararse en las piernas). A diferencia de la mayoría de los insectos atraídos por la luz, las abejas permanecieron varados casi inactiva al día siguiente hasta la muerte. Las abejas de miel que dejó a sus colmenas en la noche tenía una tasa mucho más alta de parasitismo por A. boreal de las abejas libando durante el día (χ 2 = 133, df 1, p <0,0001) ( Figura 3 ). De octubre 2009 a enero 2010 las tasas de parasitismo fueron tan altas como 91% en una muestra de abejas actividad nocturna con una tasa de parasitismo promedio de 63% para ese período (SD = 18.5, Rango = 32% -91%, n = 266 abejas) ( Figura 3 ). Durante el mismo período, las abejas libando recogidos en la colmena tenía una tasa de parasitismo promedio de sólo el 6% (SD = 8,2, Rango = 0% -17,4%, n = 162 abejas) ( Figura 3 ). Parasitismo decapitadoras disminuyó de febrero a través de la primavera de 2010 antes de subir en mayo y en horas pico de nuevo en el otoño de 2010 ( Figura 3 y Figura S5 ). Durante este segundo pico registrado de parasitismo (julio 2010-noviembre 2010), las abejas varados nuevamente tuvieron una tasa significativamente más alta de parasitismo de cazadores-recolectores (χ 2 = 255,3, df 1, p <0,0001).Las tasas de parasitismo de las abejas varados nuevamente alcanzó un máximo de casi el 90% (media = 50%, SD = 19, rango = 11% -88%, n = 860 abejas), mientras que cazadores-recolectores tenían una tasa mucho más baja de parasitismo (media = 4%, rango = 0% -11%, n = abejas 422).Estos picos de la infección se produjo justo antes o durante la época del año cuando las pérdidas de las colonias de abejas melíferas de CCD y otras causas de pico en la bahía de San Francisco.

Figura 3. Las tasas de parasitismo decapitadoras en las abejas melíferas.

(A) Las tasas de parasitismo de las abejas en la muestra de abril de 2009 hasta noviembre de 2010. Línea sólida negro muestra las tasas de las abejas varados por debajo de las luces en el campus de San Francisco State University, mientras que la línea discontinua de color rosa muestra las tasas de las abejas libando. Las abejas encuentran atrapados bajo las luces se tomaron muestras a intervalos regulares durante el año 2009 y se tomaron muestras cada dos días en el año 2010. Recolectores se tomaron muestras mensuales de nuestra colmena principal del estudio.Una tasa de cero indica que las muestras de la época no contienen abejas parasitadas. Se compararon las tasas de parasitismo en las abejas libando varados y activa recogida en San Francisco State University desde octubre de 2009 hasta enero de 2010 y entre julio de 2010 diciembre de 2010 (cuando las tasas de parasitismo alcanzó su punto máximo). 2009-2010 las tasas máximas de parasitismo en las muestras de abejas cadena (media = 60%, n = 276) fueron significativamente mayores que las tasas máximas de parasitismo en los recolectores activos de nuestra colmena principal del estudio (media = 6%, n = 164) (χ 2 = 126.7, df 1, p <0,0001). Este patrón se repitió en 2010 cuando las tasas de pico de parasitismo en las muestras de abejas cadena (media = 50%, n = 860) fueron de nuevo significativamente mayores que las tasas de parasitismo en los recolectores activa (media = 4%, n = 422) (χ 2 = 255,3, df 1, p <0,0001). (B) Proporción de las abejas parasitadas por phorids en las muestras de abejas recogidas varados desde el Salón de aterrizaje Hensill bajo luces (línea punteada) y de muestras de abejas de la colmena de los recintos durante la noche en las noches al lado (línea sólida). Las tasas de parasitismo de las abejas atrapadas en los recintos son muy parecidas a las tasas en las abejas varados encontrado bajo las luces durante el mismo período y el número de abejas encontradas bajo las luces se redujo significativamente cuando la caja estaba en su lugar (t-test de Welch p <0,0001) lo que indica que las abejas varados vino de nuestra colmena principal del estudio y fueron parasitados antes de abandonar la colmena.

doi: 10.1371/journal.pone.0029639.g003

Que periódicamente coloca una caja en nuestra colmena principal del estudio y las tasas de evaluación del parasitismo de las abejas que dejó a su colmena en la noche ( Figura S4D ). Las muestras de las abejas atrapadas en el recinto (n = 10 muestras) varió desde 24 hasta 62 abejas por noche (media = 43,5, SD = 15,4). Estas muestras seguido de cerca las tasas de parasitismo de las abejas atrapados bajo las luces cerca de la muestra el día después de que el recinto estaba en su lugar ( Figura 3B ). Por otra parte, el número de abejas varados bajo las luces cada noche se redujo significativamente cuando la caja estaba en su lugar (media = 0.8, SD = 1.14, rango = 0-3, n = 8) en comparación con una media de 15,7 (SD = 7,26, rango = 6.29, n = 157) abejas varados por falta de caja noches (Welch t-test, p <0,001). Esto indica que las abejas varados provenían principalmente de nuestra colmena principal del estudio. Las pocas abejas que se encuentran varados en las noches cuando la caja estaba en su lugar probablemente vino de nuestra colmena de observación cercana.Estos datos confirman que las abejas actividad nocturna fueron parasitados antes de salir de su colmena y se sintieron atraídos por la luz cercana.

Discusión

 

El comportamiento se observó en las abejas de la miel es similar a la de las hormigas de fuego importadas, Solenopsis invicta parasitadas por el decapitadoras, Pseudacteon tricuspis [21] , y sugiere que A. Borealis es manipular el comportamiento de las abejas a su huésped. La manipulación de acogida como ha sido propuesto como una estrategia de adaptación evolutiva de una serie de interacciones entre una variedad de parásitos y sus huéspedes [22] . Los trabajos recientes sobre las larvas de la polilla gitana infectados con nucleopoliedrovirus identifica el mecanismo genético de la manipulación de acogida. El virus manipula las larvas de larvas de inducir un comportamiento para subir a la copa de los árboles, donde mueren, licuar y la lluvia de virus en el follaje de abajo para infectar a nuevos huéspedes [23] . Este estudio es un claro ejemplo de las modificaciones de la expresión de un gen clave en un huésped y apoya la teoría de fenotipo extendido propuesto por Richard Dawkins [24] , [25] . En el caso que nos ocupa, quizá A. boreal manipula el comportamiento de las abejas de miel, cambiando el ritmo circadiano de una abeja, su sensibilidad a la luz u otros aspectos de su fisiología. Con el fin de demostrar que los cambios en el comportamiento de las abejas que el documento se adaptan a la mosca, los estudios futuros tendrán que documentar que el cambio en el comportamiento conduce a un aumento en el gimnasio del parásito [22] . Alternativamente, la infección decapitadoras puede ser uno de los factores de estrés como resultado de varios en la actividad aberrante de la noche ( Figura S5 ). Si es verdad, abejas enfermas altruista puede dejar sus colmenas para reducir el riesgo a compañeros de la colmena [26] . Una respuesta similar se ha propuesto para los abejorros parasitadas por moscas conopid [27] y las hormigas infectadas por un hongo patógeno [28] . Si esta explicación es correcta, las abejas también podrían salir de su colmena en respuesta a las infecciones como las que hemos detectado con la APM. Compañeros de la colmena las abejas también pueden detectar parásitos debido a los cambios de conducta o fisiológicos asociados con el parasitismo y expulsarlos de la colmena. Por ejemplo, Richard et al. [29] mostraron que las abejas intencionalmente infectados con bacterias lipopolysaccarides expresado perfiles muy diferentes de hidrocarburos cuticulares en comparación con abejas sanas y saludables que las abejas de recubrimiento con el perfil de hidrocarburos de abejas infectadas despertado agresión significativa a las abejas por compañeros de la colmena. Si el parasitismo por A. boreal altera la firma de una abeja química, esto podría proporcionar un medio para que los trabajadores para detectar decapitadoras infectadas por compañeros de la colmena.

Nuestros datos muestran claramente que las abejas parasitadas decapitadoras demostrar el comportamiento inusual de abandonar sus colmenas por la noche. Sin embargo, no podemos excluir la posibilidad de que algunas abejas parasitadas también abandonar la colmena durante tiempos normales de alimentación y mueren a cierta distancia de la colmena. Futuros estudios experimentales comparando los patrones de actividad diaria de los trabajadores frente a parásitos parasitados son necesarios para poner a prueba esta posibilidad.

Hasta ahora, las abejas de América del Norte han aparecido relativamente libre de insectos parasitoides [30] , [31] . En América del Sur y Central, las abejas de miel son atacados por numerosas especies de moscas decapitadoras, casi ninguno de los cuales se producen en América del Norte [32] ,[33] . Nuestro estudio establece A. boreal como un parásito novela de las abejas y la colmena documentos comportamiento abandono consistente con un síntoma de la CCD. Esta es una causa de preocupación, ya otras especies de moscas decapitadoras puede afectar dramáticamente el comportamiento de insectos sociales y se utilizan como agentes de control biológico de hormigas de fuego introducido [21] , [34] - [36] . Hasta ahora, nuestra sección principal del estudio ha persistido a pesar de las pérdidas de parasitismo decapitadoras y la infección por una variedad de patógenos. La variación estacional se ve en las tasas de parasitismo en nuestra sección principal del estudio es consistente con otras enfermedades de las abejas [16] , pero la relación, en su caso, no se entiende completamente. La variación estacional podría estar asociada con el ciclo de vida de la mosca en el que las tasas de parasitismo de las abejas de miel fluctuar como A. poblaciones borealestacionalmente aumento y disminución. El hecho de que no encontramos adultos vuelan dentro de las colmenas puede indicar que phorids no sobreviven en grandes cantidades a finales del invierno, cuando las abejas libando están inactivos. Un estudio detallado de una muestra más grande de las colmenas que se necesita para medir los efectos de diferentes densidades de parasitismo decapitadoras en la salud de la colmena.

Es posible que A. boreal ampliando su radio de incluir la abeja de la miel no nativas hace muchos años y ha pasado desapercibido porque las abejas infectadas por abandonar la colmena y las moscas se produjo sin ser detectado en bajas densidades. Creemos que es más probable que el fenómeno que el informe representa un cambio de sede reciente y un problema emergente para las abejas melíferas.Las abejas de miel son algunos de los insectos más estudiados en Norteamérica debido a su importancia para la agricultura. La meticulosa atención dada a las abejas melíferas por los seres humanos sugiere que phorids se han detectado pronto como el cambio de sede se produjo hace mucho tiempo, especialmente desde la detección del parásito no requiere técnicas sofisticadas. La observación de las abejas muertas en tan poco tiempo como cinco días debe detectar la presencia de decapitadoras. Además, las abejas de miel han habitado las zonas adyacentes a la luz eléctrica por lo menos durante un siglo, sin embargo, sabemos de ningún informe de un gran número de abejas de miel agregar alrededor de las luces hasta hace poco. Este último punto sugiere que, incluso si las moscas están presentes en números bajos en las colonias de abejas en el pasado, algo que ha sucedido recientemente que se ha incrementado la densidad de la toma phorids una amenaza emergente. Para probar la presencia de phorids en las abejas melíferas en ocasiones anteriores, la APM se podría utilizar para analizar conservan las abejas de las décadas anteriores. Estudios adicionales de la distribución y frecuencia de parasitismo decapitadoras de las abejas de miel en América del Norte son necesarias para evaluar el alcance de este fenómeno y para detectar si se está expandiendo a otras áreas o si ya está muy extendida. La forma más sencilla de controlar el abandono nocturno de las colmenas es colocar trampas de luz cercano y luego monitorear las abejas atrapadas en la emergencia de las larvas de decapitadoras. Esperamos que nuestro estudio y los métodos permitirá a los apicultores profesionales y aficionados para recoger muestras vital de las abejas que salen de la colmena en la noche, con el fin de determinar si estas abejas están parasitadas por phorids.

El cambio de sede de los abejorros de abejas de la miel tiene implicaciones potencialmente importantes para la dinámica de la población de A. boreal. Los abejorros viven en colonias relativamente pequeñas que duran sólo una temporada con sólo invernar reinas. Las abejas de miel, por el contrario, viven en colonias mucho más grande con decenas de miles de personas que viven en colmenas que son cálidos, incluso en invierno. Si estas moscas tienen o pueden adquirir la capacidad de reproducirse dentro de las colmenas que podría aumentar su tamaño de la población y los niveles de virulencia. Por otra parte, cientos ya veces miles de colonias de abejas comerciales a menudo se encuentran en las proximidades de uno al otro en las zonas agrícolas. Una densidad de host de alta podría dar lugar a explosiones de población de la mosca y un gran impacto en las colmenas que parasitan. Por otra parte, A. boreal ya está ampliamente distribuida en América del Norte [14] ( Figura 1 ).

Aunque no nos muestra las abejas colmena, tales como enfermeras, para determinar si estos trabajadores se están parasitados en el nido, las tasas de infección de recolectoras sola todavía puede tener un fuerte efecto sobre la salud de la colmena en general. Koury et al. [37] la dinámica de población de la colonia y el modelo predice que la pérdida significativa de cazadores-recolectores (más allá de un umbral determinado) puede causar una rápida disminución de la población y el colapso de la colonia. Su modelo también predice que la pérdida significativa de cazadores-recolectores lleva a la colmena las abejas entrando en la población de alimentación a edades más tempranas que la falla normal de colonia de aceleración. Mientras que nuestros datos indican tasas de aparición relativamente bajo de infección por la mosca, nuestros datos sugieren que las tasas de infección APM que son considerablemente más altos. Si las abejas parasitadas son numerosas o co-ocurren con otras infecciones, una colmena puede llegar a un punto de inflexión que conduce a su colapso. La detección de A. Boreal en las abejas de Dakota del Sur y Bakersfield, CA subraya el peligro que podría amenazar las colonias de abejas en todo Estados Unidos. Movimiento de colmenas comerciales infección podría extenderse rápidamente decapitadoras, especialmente teniendo en cuenta el número de estados que las colmenas comerciales de cruz y se despliegan pulg

La detección de DWV y N. ceranae en adultos A. boreal plantea una serie de preguntas. ¿Estos patógenos tienen una influencia negativa en la vitalidad de las moscas o afectar a su comportamiento? En este sentido, las infecciones por microsporidios reducir la viabilidad de algunos parasitioids insectos [38] , pero no en los parasitoides decapitadoras de la S. de hormigas de fuegoinvicta [39] . Se phorids implicados en la transmisión de estas y quizás otras enfermedades de las abejas de miel en una colonia? Se phorids implicados en la transmisión de patógenos entre las abejas no autóctonas y las abejas nativas? Alternativamente, se phorids un callejón sin salida para los agentes patógenos ya que, como los parasitoides que podrían matar a su anfitrión antes de que el patógeno puede multiplicarse? Contestar a estas preguntas requieren un estudio más detallado. Sin embargo, sólo porque un agente infeccioso en última instancia, es fatal no significa que no puede ser un vector para otros patógenos. Esto es especialmente cierto si el tiempo de desarrollo de las larvas decapitadoras es larga. Los resultados del documento que decapitadoras infectadas por cazadores-recolectores pasan tiempo en la colmena antes de abandonarlo. Este período de la infección (antes de la suspensión) podría extenderse por una semana o más dando tiempo a los agentes patógenos que se multiplican.

En el caso de DWV, el virus ha sido aislado de las heces y los intestinos de las abejas reina [40] . Si esto es cierto de los trabajadores, que es un medio potencial de transmisión del virus en los fluidos intercambiados por las abejas de miel o por contacto directo. Vectorización de microsporidiosis durante la oviposición ocurre en algunos parásitos himenópteros parasitoides [41] , [42] . Este modo de transmisión ha sido documentado en condiciones de laboratorio durante al menos tres diferentes patógenos parasitoide-huésped complejos [42] . Al igual que en A. borealis, phorids Pseudacteon han dado positivo para patógenos microsporidio de hormigas de fuego y se ha sugerido como un posible vector a través de la oviposición [39] . Hasta el momento, no está claro qué proporción de A. borealataques en el resultado salvajes en el parasitismo exitoso, sin embargo, es concebible que los ataques sin éxito podría perforar el abdomen y exponer la abeja objetivo de cualquier agente patógeno infeccioso o llevado por el decapitadoras. Teniendo en cuenta otros parásitos de abejas, como el ácaro Varroa destructor, han sido implicados como un vector de DWV, Cachemira de abejas, el virus de la parálisis lenta, y el virus israelí de parálisis aguda, [10] - [12] , las moscas decapitadoras también puede actuar como vectores para DWV o N. ceranae. Por último, N. ceranae y DWV han sido aislados de los abejorros que sugiere que el intercambio de patógenos entre las abejas y los abejorros se ha producido [43] .

Boreal Apocephalus también puede ser una amenaza para los polinizadores nativos, ya que parasita diversas especies de abejorros y avispas (Vespula spp) [13] , [14] . Las abejas salvajes abejorros están experimentando descensos importantes en América del Norte [44] , [45] . Hasta ahora, la atención se ha centrado en los agentes patógenos emergentes como Crithidia bombi y Nosema bombi.En el laboratorio, los abejorros parasitados por A. boreales muestran una dramática reducción en la esperanza de vida en comparación con las abejas parasitadas [13] . El alto índice de parasitismo en algunas de nuestras muestras de abejorros alimentación y el anterior nivel de parasitismo de alta de Canadá [13] , sugieren que el parasitismo por A. boreal, especialmente en combinación con la infección por patógenos emergentes, podría poner una presión significativa sobre las poblaciones de abejorros.Si es así, el parasitismo decapitadoras o la transmisión de patógenos a los abejorros pueden contribuir a una cascada de efectos en las comunidades vegetales y agrícolas que se basan en los abejorros como polinizadores. Además, la abeja de la miel nacional es potencialmente A. billete de Borealis a la invasión global. Establecimiento de A. boreales en otros continentes, donde su linaje no se produce, donde las abejas de acogida son particularmente ingenuo, y donde más cambios de acogida podría llevarse a cabo, podría tener consecuencias negativas para la agricultura en todo el mundo y para la biodiversidad de la no-Norte América avispas y las abejas.

Métodos

 

Ética declaración

Las muestras de San Francisco Bay Area abejas y abejorros se obtuvieron con los permisos adecuados de los apicultores, propietarios de tierras y el San Francisco Departamento de Recreación y Parques.

Los procedimientos de muestreo

Tomamos muestras de las abejas a partir de una variedad de circunstancias. Nuestras muestras principales fueron los siguientes: 1) Las abejas encuentran atrapados bajo las luces cerca de la entrada principal al Salón de Hensill en la San Francisco State University ( Figura S4A -C). Desde abril de 2009 hasta enero de 2010, una parte de las abejas encuentran atrapados bajo las luces se tomaron muestras a intervalos irregulares (rango = 2-112 abejas por ejemplo). De febrero a noviembre de 2010, las abejas varados fueron muestreados a intervalos de dos días (rango = 2-56 abejas por muestra) ( Figura 3 ). Todas las abejas fueron absueltos por debajo de las luces antes de la puesta del sol para asegurarse de que las abejas sólo de una noche de vuelo fueron incluidos en cada muestra a la mañana siguiente. Las muestras consistieron de todas las abejas encuentran atrapados bajo las luces. 2) Hemos recogido las abejas activas, alimentación mensual de nuestra colmena estudio principal en el campus de San Francisco State University. Las muestras consistieron de 50 recolectores de entrada recogidos en los distintos viales de Drosophila y las muestras de 50 o más recolectores de salida recogidos mediante la colocación de una red estándar de insectos aéreos frente a la entrada de la colmena durante 30-60 segundos. Se comparó la tasa de infección en muestras de las recolectoras y recolectores saliente entrante. No se encontraron diferencias significativas entre estos grupos (Test exacto de Fisher p = 0,32). Por lo tanto, ambos grupos se utilizan para determinar tendencias a largo plazo en las tasas de infección en las abejas de activos, búsqueda de alimento ( Figura 3 ). Esto nos permitió comparar las tasas de infección de las abejas libando vs varados. 3) En forma periódica colocó un 1,83 m x 1,83 m x 1,83 m del recinto (Nicamaka Pop-Up sombra Playa / tienda) a través de la colmena después del atardecer y se lo quitó antes del amanecer ( Fig. S4A ). Se recogieron todas las abejas capturadas en el recinto. Antes de la creación de la caja, hemos eliminado todas las abejas de la zona bajo las luces cercanas. Esto nos permitió comparar el número de abejas atrapados bajo las luces durante los experimentos de caja con el número de abejas varado el día después de los experimentos recinto. 4) En abril de 2010, se estableció una colmena de observación que nos permitió observar en la colmena las actividades y verificar la presencia de phorids dentro de la colmena.

Con el fin de encuesta sobre la prevalencia de parasitosis en áreas cercanas, se recogieron las abejas varados y alimentación de una variedad de lugares en la Bahía de San Francisco y de las colmenas de los apicultores locales que aceptaron participar en nuestro estudio. En dos de estos lugares ( Tabla S1y S2 ), las abejas procedían de zonas cercanas a las colmenas silvestres. La colmena silvestre en la San Francisco State University ha estado en vigor durante varios años y estuvo presente antes de nuestra colmena principal del estudio aparecido en el campus. Abejas de la colmena silvestre cerca de este se encontraron atrapados bajo una luz que se encuentra inmediatamente adyacente al árbol que contiene la colonia. La colmena silvestre segundo fue en un árbol cerca de la Academia de Ciencias de California y fue descubierto en nuestro estudio. Su historia es desconocida. Hemos recogido las abejas cadena de debajo del árbol que ocupaba. Además, se recolectaron muestras de dos especies de abejorros de la Bahía de San Francisco, Bombus vosnesenskii y B. melanopygus ( Tabla S1 ).

Evaluación de las tasas de parasitismo

A fin de evaluar el nivel de parasitismo, las abejas de todas las muestras fueron introducidas en el laboratorio y se limita a temperatura ambiente (19-20 ° C) en sobres de papel cristal o de los recipientes de cría de Drosophila entre abril de 2009 noviembre de 2010. Se verificaron las abejas confinadas al día durante un período de dos semanas y registraron el número de larvas decapitadoras que surgieron. Además, se registró la fecha de aparición de larvas de un subconjunto de 636 abejas parasitadas y duración de la pupa estadio para un subconjunto de 94 pupas.

Laboratorio decapitadoras-miel de abeja infecciones

Con el fin de observar las interacciones entre phorids y las abejas, las moscas adultas se obtuvieron de una cámara de incubación aprovisionado con un alimentador (una paja de 2,54 cm de plástico llena de algodón empapado en agua con azúcar) y se deja reposar por lo menos un día en un recipiente provisto con platos que contienen algodón empapado en agua con azúcar y miel soluciones. Las moscas adultas fueron colocados en una caja de plástico transparente de aproximadamente 24 cm x 12 cm x 13,5 cm, y las abejas individuales se introdujeron en ellos. Con cada presentación, se registró si phorids se acercó a la abeja y demostró el comportamiento de oviposición. Después de la exposición, las abejas se mantuvieron vivos en contenedores provistos con agua de azúcar y las soluciones de miel.

Código de barras de secuenciación y comparación filogenética

Hemos utilizado los códigos de barras de ADN para confirmar que el phorids morfológicamente similares a los abejorros y las abejas eran conespecíficos ( Figura S1 ). Alta similitud genética entre los dos también apoyaría la idea de que el nativo de A. Borealis ha ampliado su rango de hospederos para incluir no nativos abejas. Se utilizó sangre Qiagen y kits de extracción de ADN de tejido (Qiagen, Valencia CA) para extraer todo el ADN celular de abejas de la miel recolectada, los abejorros y las pupas decapitadoras. Hemos utilizado estándares CO1 primers [46] (IDT, Coralville IA) (FWD, 5 'TAAACTTCAGGGTGACCAAAAAATCA ... REV, 5. GGTCAACAAATCATAAAGATATTG) y las siguientes condiciones de PCR (1 ciclo de 95 ° C 1 min, 5 ciclos de 95 ° C 1 min, 45 ° C 1,5 min, 72 ° C 1,5 min, 35 ciclos de 95 ° C 1 min, 50 ° C 1,5 min, 72 ° C 1,5 min, 1 ciclo de 72 ° C 5 min) y productos visualizados en agarosa al 1% geles. Las reacciones de PCR fueron purificados utilizando columnas QiaQuick (Qiagen, Valencia CA) y se envía a Elim biofarmacéuticos Inc (Hayward, CA) para la secuenciación de Sanger dideoxi estándar tanto en la dirección de avance y retroceso utilizando la CO1 primers.Lecturas de cada orientación se contiged manualmente utilizando Sequencher (v4.8 Gene Codes Corporation Ann Arbor, MI), y los desajustes de ADN fueron comparados visualmente al cromatograma de ADN para corregir las bases mal llamado. Corregido, contigs fueron alineadas utilizando ClustalX[47] secuencias conocidas de código de barras decapitadoras y un árbol vecino a participar en 1000 se ha generado mediante repeticiones de arranque.

El análisis de microarrays

Un microarray de patógenos de artrópodos (APM) [16] , [19] como todos los virus de la abeja de miel conocida, hongos y bacterias patógenas de las abejas y los ácaros oligos específicos fue ampliado con productos específicos para el gen 18S rRNA decapitadoras. Utilizando larvas decapitadoras, el ARN total añadidos en miel de abejas parasitadas de ARN total, el ensayo de PCR fue capaz de detectar una parte decapitadoras de 10.000 abejas partes a partir de 5 ng de cDNA, lo que sugiere que las infecciones relativamente temprana pueden ser detectados. En total, 378 muestras recolectadas 2.008 a 2010 fueron examinados, incluyendo una de 20 colmenas tiempo-curso de estudio de la muestra aproximadamente cada dos semanas como colmenas comerciales migrado desde Mississippi a Dakota del Sur y finalmente a California ( Figura 1 ). En este caso, cada cinco trabajadores agrupados fueron seleccionadas por PCR y secuenciación de Sanger del gen 18S rRNA decapitadoras.

Insectos enteros se homogeneizaron en 1 ml de Trizol 01:01: PBS con una bola de acero de 5 mm en II TissueLyzer a 30 Hz durante 4 min. Ácido nucleico total fue extraído por la adición de 100 l de cloroformo y la centrifugación, seguido de precipitación con isopropanol. Para cada muestra, una cuarta parte del total de los ácidos nucleicos (1.5 mg) fue preparado al azar con Superscript II (Invitrogen) con imprimación RDA (5'GTTTCCCACTGGAGGATANNNNNNNNN). Segundo capítulo de síntesis se realizó dos veces con el mismo cebador y la polimerasa del ADN Sequenase (USB). Una cuarta parte de esta reacción se amplificó con la Taq polimerasa y un único adaptador de imprimación RDB (5'GTTTCCCACTGGAGGATA). Este material amplificado al azar fue utilizado para la detección de decapitadoras rRNA con el primer par decapitadoras-rRNA-1F (GTACACCTATACATTGGGTTCGTACATTAC)y 1R (GAGRGCCATAAAAGTAGCTACACC) en una Taq polimerasa PCR, con una temperatura de 57 ° C.

Para la detección de patógenos mediante microarrays, el material amplificado al azar y se amplificó aún más marcado con un tinte RdC imprimación vinculados (5'Cy3-GTTTCCCACTGGAGGATA), columna purificada y se hibridó con un microarray de ADN 70-mer en 3 x SSC, 50 mM HEPES y 0,5% SDS a 65 ° C durante la noche. Microarrays fueron digitalizadas en un escáner Axon, 4000A y analizar visualmente o con el paquete de análisis de cluster [48] . Todos los puntos de microarrays que indica la presencia de agentes patógenos fueron confirmados por PCR y secuenciación de Sanger con cebadores Nosema ceranae F-4186 (5'-CGGATAAAAGAGTCCGTTACC) y R-4435 (5'-TGAGCAGGGTTCTAGGGAT) [49] y DWV-F-1165 ( 5'-CTTACTCTGCCGTCGCCCA)-R-1338 (5'-CCGTTAGGAACTCATTATCGCG) [50] .

Disponibilidad de datos y cumplimiento de las normas

La A. secuencia de código de barras boreal mitocondrial (ID # JF798506) and18S secuencia del gen rRNA (ID # JF808447) han sido depositados en GenBank. Diseño de APM y los resultados han sido presentados a GEO (GPL11490 diseño de la adhesión y el conjunto de la adhesión de datos GSE28235) y son compatibles con MIAME.

Información de apoyo

 

Figura S1.

ClustalX alineación de 450 pb del citocromo oxidasa I de ADN obtenidos a partir de códigos de barras de las abejas infectadas (muestras 19-24,26-31,34,35) y abejorros (muestras 33,36).Bidireccional secuencia Sanger indica que sólo dos posiciones variadas ( 88, 288) en una sola muestra cada uno. Todas las muestras tenían menos de 0,22% divergencia (es decir, 1 pb).

(PDF)

Figura S2.

A. boreal ARNr 18S y citocromo oxidasa mitocondrial I (COI) la secuencia del ADN utilizado para los códigos de barras y APM.

(PDF)

S3 figura.

Calendario de eventos de la historia de la vida en el parasitismo de las abejas por A. boreal. (A) Período de tiempo después de la toma de muestras hasta que las larvas decapitadoras salió de sus anfitriones de abejas (media = 7,14 días, SD = 1,68, n = 636). (B) El número de larvas por abeja decapitadoras infectadas en las muestras de varios lugares (media = 4,8, SD = 2,45, n = 961). (C) Duración del período de pupa (media = 27.9 días, SD = 1,9, n = 94).

(PDF)

Figura S4.

San Francisco State University Hensill sitio de estudio Hall. (A) sección principal del estudio, la flecha azul indica la dirección que las abejas volar para llegar a la luz cerca. (B) de aterrizaje por encima de la colmena donde las abejas varados fueron recogidos y la luz (C) inmediatamente encima de la superficie mostrando las abejas atraídas a él desde la noche anterior. (D) Una configuración típica caja.

(PDF)

Figura S5.

El número de abejas parasitadas (rojo) en comparación con todas las abejas (negro) recogidos en el sitio de San Francisco de la Universidad Estatal de recogida Hensill Hall. Cabe destacar que las abejas numerosas fueron recogidos de las luces y el aterrizaje en meses, incluso cuando el nivel de parasitismo fue baja. Nuestro método de cría directa puede haber subestimado la tasa de parasitismo durante la primavera de 2010 ya que la matriz de patógenos de artrópodos (APM) se indica una mayor tasa de parasitismo durante abril y principios de mayo que hemos observado en nuestro rearings. La APM también se detectó un alto nivel de la infección por Nosema ceranae y el virus de las alas deformadas durante ese período.

(PDF)

Tabla S1.

Miel de abejas y abejorros sitios de recolección de las abejas en la bahía de San Francisco.Ubicación de las colmenas, que no dió el parasitismo en la bahía de San Francisco están sombreadas en gris claro. Lugares donde las abejas y la recolección varados y abejorros fueron recogidos están sombreadas en gris oscuro.

(PDF)

Tabla S2.

Resultados de patógenos de artrópodos Microarray. Códigos de ubicación son la colmena principal del estudio (HHH), varados en el aterrizaje cerca de la colmena principal (HHI), recinto principal de la colmena (HHC), la observación de la colmena (OH), cerca de la colmena silvestre en San Francisco State University (GYMA) , colmenas salvajes cerca de California Academy of Sciences (CAS), X indica si infectadas por phorids, Nosema ceranae, o el virus de las alas deformadas.

(PDF)

S3 mesa.

La tasa de parasitismo de Bombus vosnesenskii la muestra de San Francisco, California lugares de mayo a noviembre de 2010.

(PDF)

Agradecimientos

 

Damos las gracias a Gretchen LeBuhn para el acceso a las colmenas en la San Francisco State University Campus, Eric Mussen de asesoramiento y para sugerir la conexión entre el cableado y atracción a la luz; Ilma Abbas, Cory Robinson, Chaundra Cox para la asistencia en el ADN de los códigos de barras, Jessica Van Den Berg para el uso de sus imágenes automontage de phorids adultos; Erika Bueno y Caitlin Papathakis para ayudar a las abejas de muestreo; Stan Williams para el asesoramiento en materia de apicultura y los apicultores siguiente de lo que nos permite probar sus colmenas: R. MacKimmie, L. Guay, T. Williams , T. Trang, Gerrie P., Sanphillippo J., R. Bowen, B. y A. Berger, Peteros K., L. Gartland, Andre M., T. Brumleve, Bairey K., L. McCloy, C. Giaioma, L. Lasar, Lawrence G., J. Chan, D. y S. Goemmel, S. Willis, Wickware P., J. Levison, Beckett R., M. McMillan, Henninger A., ​​B. y Reese. Damos las gracias a Bret Adee y los apicultores en las granjas de miel Adee para las colecciones en SD. Andy Zink, Neil Tsutsui, Gene Robinson, Kung GIAR-Ann y tres revisores anónimos valiosos comentarios sobre el manuscrito.

Autor Contribuciones Arriba

Concebido y diseñado los experimentos: JH AC AC CQ SD CR JD CS. Los experimentos realizados: JH AC AC CQ SD CR TS. Analizaron los datos: JH AC CS CR JD TS BB. Reactivos contribuyó / materiales / herramientas de análisis: JD CR. Escribió el documento: JH AC CS BB CR. Descubierto decapitadoras / abeja fenómeno: JH. Phorids fotografiado y las abejas: CQ JH.

Referencias Arriba

1.                Williams GR, Tarpy DR, vanEngelsdorp D, Chauzat M, Cox-Foster DL, et al (2010). Desorden del colapso de colonias en su contexto. Bioensayos 32: 845-846. doi: 10.1002/bies.201000075 .

2.                Oldroyd BP (2007) ¿Qué está matando a las abejas de miel de América? PLoS Biol 5: e168. doi:10.1371/journal.pbio.0050168 .

3.                vanEngelsdorp D, Evans JD, Saegerman C, C Mullin, Haubruge E, et al (2009) desorden del colapso de colonias:. un estudio descriptivo. PLoS ONE 4 (8): e6481. doi:10.1371/journal.pone.0006481 .

4.                Ratnieks FLM, Carreck NL (2010) Claridad en el colapso de abejas? Ciencia 327:. 152-153BUSCAR ESTE ARTÍCULO EN LÍNEA

5.                RM Johnson, Evans J, Robinson GE, Berenbaum MR (2009) Los cambios en la abundancia de transcripción relacionados con el trastorno del colapso de colonias de abejas melíferas (Apis mellifera). Proc Natl Acad Sci EE.UU. 106:. 14790-14795 BUSCAR ESTE ARTÍCULO EN LÍNEA

6.                Higes M, R Martín-Hernández, E-Garrido Bailón, AV González-Porto, García-Palencia P, et al (2009). Colapso Honeybee colonia debido a Nosema ceranae en los colmenares profesionales.Medio Ambiente y Microbiología Rep 1 (2):. 110-113 BUSCAR ESTE ARTÍCULO EN LÍNEA

7.                Genersch E (2010) Miel de abeja patología: las amenazas actuales a las abejas y la apicultura.Apl Microbiología Biotecnología 87:. 87-97 ENCUENTRE ESTE ARTÍCULO EN LÍNEA

8.                Anderson DL, Trueman JWH (2000) Varroa jacobsoni (Acari: Varroidae) es más de una especie.Exper y la aplicación Acar 24:. 165-189 BUSCAR ESTE ARTÍCULO EN LÍNEA

9.                Cocine DC, Thomas MB, Cunningham SA, et al. (2007) Predecir el impacto económico de una especie invasora en un servicio ambiental. Eco APPL 17:. 1832-1840 ENCUENTRE ESTE ARTÍCULO EN LÍNEA

10.            Chen SY, JS Pettis, JD Evans, M Kramer, Feldlaufer MF (2004) La transmisión del virus Cachemira de las abejas por el ácaro ectoparásito Varroa destructor. Apidologie 35:. 441-448 BUSCAR ESTE ARTÍCULO EN LÍNEA

11.            Di Prisco G, Pennacchio F, E Caprio, Boncristiani HF Jr, Evans JD, et al. (2011) Varroa destructor es un vector eficaz de virus israelí de parálisis aguda de la abeja de la miel, Apis mellifera. J Gen Virol 92:. 151-155 BUSCAR ESTE ARTÍCULO EN LÍNEA

12.            Santillán-Galicia MT, fianza BV, Clark SJ, Alderson PG (2010) La transmisión del virus de las alas deformadas y el virus de la parálisis lenta a las abejas adultas (Apis mellifera L.) por el ácaro Varroa destructor. J de la Resolución Apicult y Bee Mundial 49:. 141-148 BUSCAR ESTE ARTÍCULO EN LÍNEA

13.            Otterstatter MC, Whidden TL, Owen RE (2002) En contraste frecuencias de parasitismo y la mortalidad de acogida entre los parasitoides decapitadoras y conopid de abejorros. Ecol Entom 27 (2):. 229-237 BUSCAR ESTE ARTÍCULO EN LÍNEA

14.            Brown BV (1993) Taxonomía y filogenia preliminar de la Apocephalus género parasitario, subgénero Mesophora (Diptera: Phoridae). Sistema Entom 18:. 191-230 BUSCAR ESTE ARTÍCULO EN LÍNEA

15.            Brown BV (1997) Revisión de la Apocephalus attophilus grupo de hormigas decapitar a moscas (Diptera: Phoridae). Contrib 468 Ciencia:. 1-60 BUSCAR ESTE ARTÍCULO EN LÍNEA

16.            Runckel C, ML Flenniken, J Engel, demócrata Ganem, Andino R, et al. (2011) Análisis temporal de la abeja de la miel microbioma revela cuatro nuevos virus y la prevalencia estacional de los virus conocidos, Nosema, y Crithidia. PLoS ONE 6 (6): e20656. doi: 10.1371/journal.pone.0020656 .

17.            Morrison LW, GC Dall'Aglio-Holvorcem, Gilbert LE (1997) el comportamiento de oviposición y desarrollo de Pseudacteon moscas (Diptera: Phoridae), parasitoides de hormigas de fuegoSolenopsis (Hymenoptera: Formicidae). Medio Entom 26 (3):. 716-724 BUSCAR ESTE ARTÍCULO EN LÍNEA

18.            Brown BV, Kung G (2006) Revisión de la Melaloncha ungulata grupo de moscas de la muerte de abejas (Diptera: Phoridae). Contribuciones de la Ciencia 507:. 1-31 ENCUENTRE ESTE ARTÍCULO EN LÍNEA

19.            Wang D, Coscoy L, M Zylerberg, PC Ávila, Boushey HA, et al (2002). Microarray basados ​​en la detección y genotipificación de patógenos virales. Proc Natl Acad Sci EE.UU. 99 (24):. 15687-15692 BUSCAR ESTE ARTÍCULO EN LÍNEA

20.            Robinson GE, Morse RA (1982) Número de abejas que se quedan toda la noche. Abeja Mundial 63:. 173-174 BUSCAR ESTE ARTÍCULO EN LÍNEA

21.            Henne DC, Johnson SJ (2007) Zombie trabajadores de hormigas de fuego: el comportamiento controlado por decapitar parasitoides volar. Sociaux Insectes 54 (2):. 150-153 BUSCAR ESTE ARTÍCULO EN LÍNEA

22.            Poulin R (2010) la manipulación de los parásitos de la conducta de acogida: una actualización y preguntas más frecuentes. Adv en el Estudio de la conducta 41:. 151-186 BUSCAR ESTE ARTÍCULO EN LÍNEA

23.            Hoover K, M Grove, Gardner M, Hughes DP, McNeil J, Slavicek (2011) Un gen de un fenotipo extendido. Ciencia 333:. 1401 ENCUENTRA ESTE ARTÍCULO EN LÍNEA

24.            R Dawkins (1982) El fenotipo extendido: el gen como unidad de selección. Nueva York: Oxford University Press. 307 p.

25.            Lambrechts L, S Fellous, Koella JC (2006) co-evolución interacciones entre el huésped y parásito genotipos. Trends in Parasitology 22: 12-16. ENCUENTRA ESTE ARTÍCULO EN LÍNEA

26.            Rueppell O, Hayworth MK, NP Ross (2010) altruista de auto-eliminación de los trabajadores de la salud comprometidos miel de abeja de la colmena. J Biol Evol 23:. 1538-1546 ENCUENTRE ESTE ARTÍCULO EN LÍNEA

27.            Müller CB, Schmid-Hempel P (1993) La explotación de bajas temperaturas como defensa contra parasitoides en los abejorros. Naturaleza 363 (6424):. 65-67 ENCUENTRE ESTE ARTÍCULO EN LÍNEA

28.            Heinze J, Bartosz B (2010) Las hormigas salen de sus nidos moribundos a morir en el aislamiento social. Curr Biol 20 (3):. 249-252 BUSCAR ESTE ARTÍCULO EN LÍNEA

29.            Richard FJ, Aubert A, Grözinger CM (2008) La modulación de las interacciones sociales por estimulación del sistema inmunológico en la miel de abeja, Apis mellifera, los trabajadores. BMC Biology 6: 50. doi: 10.1186/1741-7007-6-50 .

30.            Feener DH, Brown BV (1997) como dípteros parasitoides. Annu Rev. Entom 42:. 73-97ENCUENTRE ESTE ARTÍCULO EN LÍNEA

31.            Schmid-Hempel P (1998) Los parásitos en los insectos sociales. Monografías de comportamiento y la ecología. New Jersey: Princeton University Press. 392 p.

32.            Brown, BV (2004) Revisión de la Udamochiras subgénero de Melaloncha la matanza de abejas moscas (Diptera: Phoridae). Diario de Zoología de la Linnean Society 140:. 1-42 ENCUENTRE ESTE ARTÍCULO EN LÍNEA

33.            González L, Brown BV (2004) Nuevas especies y registros de Melaloncha (Udamochiras) matando a las abejas moscas (Diptera: Phoridae). Zootaxa 730: 1-14. ENCUENTRE ESTE ARTÍCULO EN LÍNEA

34.            Orr MR, SH Seike, WW Benson, Gilbert LE (1995) Moscas eliminar las hormigas de fuego.Naturaleza 373 (6512):. 292-293 BUSCAR ESTE ARTÍCULO EN LÍNEA

35.            Porter SD (2000) la especificidad del huésped y la evaluación de riesgos de la liberación de la mosca de curvatus Pseudacteon decapitar a un agente de control biológico clásico de hormigas de fuego importadas. Biol control 19 (1):. 35-47 ENCUENTRE ESTE ARTÍCULO EN LÍNEA

36.            Morrison LW, Porter SD (2005) Las pruebas de impacto a nivel de población de moscas introducido Pseudacteon tricuspis, parasitoides de hormigas Solenopsis decapitadoras fuegoinvicta. Biol control 33 (1):. 9-19 BUSCAR ESTE ARTÍCULO EN LÍNEA

37.            Koury DS, MR Myerscough, Barron AB (2010) Un modelo cuantitativo de la dinámica de población de la colonia de abejas. PLoS ONE 6 (4): e18491. doi: 10.1371/journal.pone.0018491 .

38.            Futerman PH, SJ Layen, ML Kotzen, C Franzen, AR Kraaijeveld, et al. (2006) los efectos de fitness y rutas de transmisión de un parásito microsporidio infecta Drosophila y sus parasitoides.Parasitology 132:. 479-492 BUSCAR ESTE ARTÍCULO EN LÍNEA

39.            Oi DH, SD Porter, SM Valles, JA Briano, Calcaterra LA (2009) Pseudacteo n decapitar a moscas (Diptera: Phoridae): son vectores potenciales de la hormiga de fuego patógenos Kneallhazia (=Thelohania) solenopsae (microsporidios: Thelohaniidae) y invictae Vairimorpha (microsporidios: Burenellidae)? Biol. de control 48:. 310-315 BUSCAR ESTE ARTÍCULO EN LÍNEA

40.            Chen SY, JS Pettis, un diccionario, Feldlaufer MF (2006) Prevalencia y transmisión del virus de la abeja. APPL y Exper Microbiol 72 (1):. 606-611 BUSCAR ESTE ARTÍCULO EN LÍNEA

41.            Brooks WM (1993) Host-parasitoide-patógeno interacciones. En: Beckage NE, SN Thompson, BA Federici, editores. Parásitos y agentes patógenos de insectos vol. 2: Los patógenos. pp 231-272.Academic Press, San Diego, CA.

42.            Becnel JJ, Andreadis TG (1999) microsporidios en los insectos. En: Wittner M, Weiss LM, editores.Los microsporidios y microsporidiosis. pp 447-501. De la Sociedad Americana de Microbiología Press, Washington, DC.

43.            Plischuk S, Martín-Hernández R, Prieto L, M Lucía, Botías C, et al (2009) del Sur de América abejorros nativos (Hymenoptera: Apidae). Infectadas por Nosema ceranae (microsporidios), un patógeno emergente de las abejas melíferas (Apis mellifera). Informes ambientales Microbiología 1 (2):. 131-135 BUSCAR ESTE ARTÍCULO EN LÍNEA

44.            Otterstatter MC, JD Thomson (2008) ¿Tiene efectos colaterales de patógenos de las abejas crían comercialmente abejorros polinizadores silvestres amenazan? PLoS ONE 3: e2771. doi:10.1371/journal.pone.0002771 .

45.            Cameron SA, JD Lozier, Strange JP, Koch JB, Cordes N, et al. (2011) Los patrones de deterioro generalizado de las abejas abejorros del Norte de América. Proc Natl Acad Sci EE.UU. 108:. 662-667 BUSCAR ESTE ARTÍCULO EN LÍNEA

46.            Folmer S, M Negro, W Hoeh, R Lutz, Vrijenhoek R (1994) primers para la amplificación de ADN mitocondrial del citocromo c oxidasa subunidad I de invertebrados metazoos diversas. Mol Biol. Mar Biotechnol 3:. 294-297 BUSCAR ESTE ARTÍCULO EN LÍNEA

47.            Larkin MA, G Blackshields, NP Brown, R Chenna, PA McGettigan, et al. (1997) Clustal W y Clustal X versión 2.0. Bioinformática 23:. 2947-2948 BUSCAR ESTE ARTÍCULO EN LÍNEA

48.            Eisen MB, PT Spellman, PO Brown, Botstein D (1998) El análisis de conglomerados y la visualización de patrones de expresión del genoma. Proc Natl Acad Sci EE.UU. 95 (25):. 14863-14868 BUSCAR ESTE ARTÍCULO EN LÍNEA

49.            Chen Y, Evans JD Smith IB, Pettis JS (2007) Nosema ceranae es un presente largo y ancho diseminar la infección por microsporidios de la abeja europea (Apis mellifera) en los Estados Unidos. J Invertir Ruta 97 (2):. 186-188 BUSCAR ESTE ARTÍCULO EN LÍNEA

50.            Chen SY, Higins JA, Feldlaufer MF (2004) cuantitativa en tiempo real con transcripción inversa-PCR y análisis de la infección por virus de las alas deformadas en la abeja melífera (Apis mellifera L.).Fecha de Medio Ambiente y Microbiología 71 (1):. 436-441 BUSCAR ESTE ARTÍCULO EN LÍNEA

 

 

 

 

Ricardo Carrera

Blog: http://apiculturauruguay.blogspot.com/

 

SI NO ACTUAMOS MORIREMOS MUCHOS EN LA RULETA GENETICA